pCMV3-N-His (Suitable for intracellular protein expession)

pCMV3-N-His Physical Map
Download sequence
pCMV3-N-His Physical Map

Comments for pCMV3-N-His:

  • • CMV promoter: bases 250-837
  • • Enhancer: bases 838-1445
  • • SV40 early promoter: bases 2345-2714
  • • Hygromycin ORF: bases 2732-3757
  • • pUC origin: bases 4400-5073
  • • Kanamycin ORF: bases 5147-5962

Cloning Sites for ORF Inserting

Cloning Sites for ORF Inserting

Expression Vector pCMV3-N-His Information Description

Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constitutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward: T7(TAATACGACTCACTATAGGG); Reverse: BGH(TAGAAGGCACAGTCGAGG)

His Tag Information

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Mammalian Expression Vectors

More Reagents and Services