After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

pCMV3-C-Myc Negative Control Vector (C-terminal Myc-tagged)

ПаспортОбзорыСвязанные продуктыПротоколы
  • Negative control for the pCMV3-C-Myc clone.
  • Vector sequence is the same as pCMV3-C-Myc, but multiple cloning sites are removed.
  • Designed for mammalian expression, stable or transient.
  • Hygromycin resistance gene for selection of stable cell lines.
pCMV3-C-Myc-NCV (Negative Control Vector) Physical Map
Vector Sequence
 Vector Name pCMV3-C-Myc-NCV
 Vector Size


 Vector Type Mammalian Expression Vector
 Expression Method Constitutive, Stable / Transient
 Promoter CMV
 Antibiotic Resistance Kanamycin
 Selection In Mammalian Cells Hygromycin
 Protein Tag Myc
 Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Schematic of pCMV3-C-Myc-NCV (Negative Control Vector) Multiple Cloning Sites

Size / Price
Каталог: CV014
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие5 Business days
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.