Быстрый заказ

pCMV3-C-HA Negative Control Vector (C-terminal HA-tagged)

    ПаспортОбзорыСвязанные продуктыПротоколы
    • Negative control for the pCMV3-C-HA clone.
    • sVector sequence is the same as pCMV3-C-HA, but multiple cloning sites are removed.
    • Designed for mammalian expression, stable or transient.
    • Hygromycin resistance gene for selection of stable cell lines.
     
    pCMV3-C-HA-NCV (Negative Control Vector) Physical Map
     
    Vector Sequence
    Download     
     
    Description
     
     Vector Name pCMV3-C-HA-NCV
     Vector Size

    6016bp

     Vector Type Mammalian Expression Vector
     Expression Method Constitutive, Stable / Transient
     Promoter CMV
     Antibiotic Resistance Kanamycin
     Selection In Mammalian Cells Hygromycin
     Protein Tag HA
     Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)
     
    Schematic of pCMV3-C-HA-NCV (Negative Control Vector) Multiple Cloning Sites

    Size / Price
    Каталог: CV013
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».