SIRP alpha cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

1/2

This product is not available, please contact order_us@sinobiological.com for relevant product if required.

SIRP alpha cDNA ORF Clone, Mouse, C-DDK (Flag®) tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1530 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutation 459 A/G not causing the amino acid variation.
Description
Full length Clone DNA of Mouse signal-regulatory protein alpha with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV2-FLAG
Restriction Sites
KpnI (two restriction sites) + XbaI (5.4kb + 0.35kb + 1.22kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

SIRP alpha cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SIRP alpha cDNA ORF Clone, Mouse, C-DDK (Flag®) tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope.

SIRP alpha cDNA ORF Clone, Mouse, C-DDK (Flag®) tag: Alternative Names

AI835480 cDNA ORF Clone, Mouse; Bit cDNA ORF Clone, Mouse; CD172a cDNA ORF Clone, Mouse; P84 cDNA ORF Clone, Mouse; Ptpns1 cDNA ORF Clone, Mouse; SHP-1 cDNA ORF Clone, Mouse; SHPS-1 cDNA ORF Clone, Mouse; SIRP cDNA ORF Clone, Mouse

SIRP alpha Background Information

Tyrosine-protein phosphatase non-receptor type substrate 1, also known as SHP substrate 1, Inhibitory receptor SHPS-1, Brain Ig-like molecule with tyrosine-based activation motifs, Macrophage fusion receptor, CD172 antigen-like family member A, SIRPA and CD172a, is a single-pass type I membrane protein which contains two Ig-like C1-type (immunoglobulin-like) domains and one Ig-like V-type (immunoglobulin-like) domain. SIRPA is ubiquitously expressed. It is highly expressed in brain and detected at lower levels in heart, placenta, lung, testis, ovary, colon, liver, small intestine, prostate, spleen, kidney, skeletal muscle and pancreas. It is also detected on myeloid cells, but not T-cells. SIRPA is an immunoglobulin-like cell surface receptor for CD47. SIRPA acts as docking protein and induces translocation of PTPN6, PTPN11 and other binding partners from the cytosol to the plasma membrane. SIRPA supports adhesion of cerebellar neurons, neurite outgrowth and glial cell attachment. It may play a key role in intracellular signaling during synaptogenesis and in synaptic function. SIRPA is involved in the negative regulation of receptor tyrosine kinase-coupled cellular responses induced by cell adhesion, growth factors or insulin. It mediates negative regulation of phagocytosis, mast cell activation and dendritic cell activation.
Full Name
signal-regulatory protein alpha
References
  • Timms JF. et al., 1999, Curr Biol. 9: 927-30.
  • Stofega MR. et al., 2000, J Biol Chem. 275: 28222-9.
  • Liu T. et al., 2005, J Proteome Res. 4: 2070-80.
  • Wolf-Yadlin A. et al., 2007, Proc Natl Acad Sci. 104: 5860-5.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait