FHL1 cDNA ORF Clone, Mouse, N-DYKDDDDK (Flag®) tag tag

Price:
Size:
Number:

FHL1 cDNA ORF Clone, Mouse, N-DYKDDDDK (Flag®) tag tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
972 bp
Description
Full length Clone DNA of Mouse four and a half LIM domains 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

FHL1 cDNA ORF Clone, Mouse, N-DYKDDDDK (Flag®) tag tag: Alternative Names

FHL-1 cDNA ORF Clone, Mouse; KyoT cDNA ORF Clone, Mouse; RAM14-1 cDNA ORF Clone, Mouse; SLIM cDNA ORF Clone, Mouse; SLIM-1 cDNA ORF Clone, Mouse

FHL1 cDNA ORF Clone, Rat, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait