FGFR2 cDNA ORF Clone, Mouse, N-Myc tag

Price:
Size:
Number:

FGFR2 cDNA ORF Clone, Mouse, N-Myc tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2181 bp
Description
Full length Clone DNA of Mouse fibroblast growth factor receptor 2 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

FGFR2 cDNA ORF Clone, Mouse, N-Myc tag: Alternative Names

AU043015 cDNA ORF Clone, Mouse; AW556123 cDNA ORF Clone, Mouse; Bek cDNA ORF Clone, Mouse; Fgfr-2 cDNA ORF Clone, Mouse; Fgfr-7 cDNA ORF Clone, Mouse; Fgfr7 cDNA ORF Clone, Mouse; KGFR cDNA ORF Clone, Mouse; KGFRTr cDNA ORF Clone, Mouse; svs cDNA ORF Clone, Mouse

FGFR2 Background Information

FGFR2, also known as CD332, belongs to the fibroblast growth factor receptor subfamily where amino acid sequence is highly conserved between members and throughout evolution. FGFR2 acts as cell-surface receptor for fibroblast growth factors and plays an essential role in the regulation of cell proliferation, differentiation, migration and apoptosis, and in the regulation of embryonic development. It is required for normal embryonic patterning, trophoblast function, limb bud development, lung morphogenesis, osteogenesis and skin development. FGFR2 plays an essential role in the regulation of osteoblast differentiation, proliferation and apoptosis, and is required for normal skeleton development. It also promotes cell proliferation in keratinocytes and imature osteoblasts, but promotes apoptosis in differentiated osteoblasts. FGFR2 signaling is down-regulated by ubiquitination, internalization and degradation. Mutations that lead to constitutive kinase activation or impair normal CD332 maturation, internalization and degradation lead to aberrant signaling. Over-expressed FGFR2 promotes activation of STAT1. Defects in CD3322 are the cause of Crouzon syndrome, Jackson-Weiss syndrome, Apert syndrome, Pfeiffer syndrome, Beare-Stevenson cutis gyrata syndrome, familial scaphocephaly syndrome, lacrimo-auriculo-dento-digital syndrome and Antley-Bixler syndrome without genital anomalies or disordered steroidogenesis.
Full Name
fibroblast growth factor receptor 2
References
  • Marie PJ, et al. (2003) Regulation of human cranial osteoblast phenotype by FGF-2, FGFR-2 and BMP-2 signaling. Histol. 17(3):877-85.
  • Park WJ, et al. (1996) Novel FGFR2 mutations in Crouzon and Jackson-Weiss syndromes show allelic heterogeneity and phenotypic variability. Hum Mol Genet. 4(7):1229-33.
  • Orr-Urtreger A, et al. (1993) Developmental localization of the splicing alternatives of fibroblast growth factor receptor-2 (FGFR2). Dev Biol. 158(2):475-86.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait