CDK9/CDC2L4 cDNA ORF Clone, Mouse, untagged

Price:
Size:
Number:

CDK9/CDC2L4 cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1119 bp
Description
Full length Clone DNA of Mouse cyclin-dependent kinase 9 (CDC2-related kinase).
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CDK9/CDC2L4 cDNA ORF Clone, Mouse, untagged: Alternative Names

PITALRE cDNA ORF Clone, Mouse

CDK9/CDC2L4 Background Information

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait