C1QB cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

C1QB cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
762 bp
Description
Full length Clone DNA of Mouse complement component 1, q subcomponent, beta polypeptide with C terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

C1QB Background Information

Complement Component 1, q subcomponent (C1q) associates with C1r and C1s in order to yield the first component of the serum complement system. Deficiency of C1q has been associated with lupus erythematosus and glomerulonephritis. C1q is composed of 18 polypeptide chains: six A-chains, six B-chains, and six C-chains. Southern blot analysis of chromosomal DNA from vertebrate species demonstrated highest similarity between the C1qB genes, followed by C1qC and finally C1qA. Sequence comparison of C1q from three different species have shown that the B chains have the strongest similarity. C1q was already present at embryonic day 14 (E14) and showed little change in abundance through six weeks postnatal. At E16, C1qB mRNA was present at high abundance in putative microglia/macrophages in cortical marginal and intermediate zones, and hippocampal analge.
Full Name
complement component 1, q subcomponent, B chain
References
  • Pasinetti GM, et al. (1992) Complement C1qB and C4 mRNAs responses to lesioning in rat brain. Experimental neurology. 118(2): 117-25.
  • Johnson SA, et al. (1994) Expression of complement C1qB and C4 mRNAs during rat brain development. Brain Res Dev Brain Res. 80(1-2): 163-74.
  • Grewal RP,et al. (1999) C1qB and clusterin mRNA increase in association with neurodegeneration in sporadic amyotrophic lateral sclerosis. Neuroscience letters. 271(1): 65-7.
  • Spielman L, et al. (2002) Induction of the complement component C1qB in brain of transgenic mice with neuronal overexpression of human cyclooxygenase-2. Acta neuropathologica. 103(2): 157-62.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait