BTLA cDNA ORF Clone, Mouse, N-DYKDDDDK (Flag®) tag tag

Price:
Size:
Number:

BTLA cDNA ORF Clone, Mouse, N-DYKDDDDK (Flag®) tag tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
918 bp
Description
Full length Clone DNA of Mouse B and T lymphocyte associated with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

BTLA cDNA ORF Clone, Mouse, N-DYKDDDDK (Flag®) tag tag: Alternative Names

A630002H24 cDNA ORF Clone, Mouse

BTLA Background Information

BTLA is a inhibitory molecule which belongs to the Ig superfamily. It down-modulates immune responses. As such, reagents that regulate the binding of BTLA to its ligand or alter BTLA signaling have significant therapeutic promise. BTLA is crucial to understand the mechanism(s) of action of these antibodies before attempting clinical applications. BTLA is not expressed by naive T cells, but it is induced during activation and remains expressed on T helper type 1 (T(H)1) but not T(H)2 cells. BTLA is a third inhibitory receptor on T lymphocytes with similarities to cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) and programmed death 1 (PD-1).
Full Name
B and T lymphocyte associated
References
  • Fourcade J, et al. (2012) CD8(+) T cells specific for tumor antigens can be rendered dysfunctional by the tumor microenvironment through upregulation of the inhibitory receptors BTLA and PD-1. Cancer Res. 72(4):887-96.
  • Kojima R, et al. (2011) Molecular basis for herpesvirus entry mediator recognition by the human immune inhibitory receptor CD160 and its relationship to the cosignaling molecules BTLA and LIGHT. J Mol Biol. 413(4):762-72.
  • Oki M, et al. (2011) A functional polymorphism in B and T lymphocyte attenuator is associated with susceptibility to rheumatoid arthritis. Clin Dev Immunol. 305656.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait