Influenza A H9N2 (A/Hong Kong/2108/2003) Nucleocapsid protein / NP ORF mammalian expression plasmid, N-GFPSpark tag

Price:
Size:
Number:

Influenza A H9N2 (A/Hong Kong/2108/2003) Nucleocapsid protein / NP ORF mammalian expression plasmid, N-GFPSpark tag: General Information

Gene
Species
H9N2
RefSeq ORF Size
1497 bp
Sequence Description
A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with ABB58967.
Description
Full length Clone DNA of Influenza A H9N2 (A/Hong Kong/2108/2003) Nucleocapsid protein with N terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Nucleocapsid / NP Background Information

Influenza A viral nucleoprotein (NP) plays a critical role in virus replication and host adaptation.The influenza A virus nucleoprotein (NP) is an essential multifunctional protein that encapsidates the viral genome and functions as an adapter between the virus and the host cell machinery. NPs from all strains of influenza A viruses contain two nuclear localization signals (NLSs): a well-studied monopartite NLS1 and a less-characterized NLS2, thought to be bipartite.

Nucleocapsid / NP cDNA ORF Clone, H1N1, Related Products

Nucleocapsid / NP cDNA ORF Clone, Influenza B, Related Products

Nucleocapsid / NP cDNA ORF Clone, H7N9, Related Products

Nucleocapsid / NP cDNA ORF Clone, H9N2, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait