Influenza A H3N2 (A/Hong Kong/1/1968) Nucleoprotein / NP Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized)

Price:
Size:
Number:

Influenza A H3N2 (A/Hong Kong/1/1968) Nucleoprotein / NP Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized): General Information

Gene
Species
H3N2
RefSeq ORF Size
1497 bp
Sequence Description
A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with P22435.2.
Description
Full length Clone DNA of Influenza A H3N2 (A/Hong Kong/1/1968) Nucleoprotein / NP.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

Influenza A H3N2 (A/Hong Kong/1/1968) Nucleoprotein / NP Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized): Alternative Names

NP cDNA ORF Clone, H3N2

Nucleocapsid / NP Background Information

Influenza A viral nucleoprotein (NP) plays a critical role in virus replication and host adaptation.The influenza A virus nucleoprotein (NP) is an essential multifunctional protein that encapsidates the viral genome and functions as an adapter between the virus and the host cell machinery. NPs from all strains of influenza A viruses contain two nuclear localization signals (NLSs): a well-studied monopartite NLS1 and a less-characterized NLS2, thought to be bipartite.

Nucleocapsid / NP cDNA ORF Clone, H1N1, Related Products

Nucleocapsid / NP cDNA ORF Clone, Influenza B, Related Products

Nucleocapsid / NP cDNA ORF Clone, H7N9, Related Products

Nucleocapsid / NP cDNA ORF Clone, H9N2, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait