WT1 cDNA ORF Clone, Human, C-OFPSpark® tag

1/2
Price:
Size:
Number:

WT1 cDNA ORF Clone, Human, C-OFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
909 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human Wilms tumor 1 with C terminal OFPSpark / RFP tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6kb + 1.6kb)
Tag Sequence
OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

WT1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

WT1 cDNA ORF Clone, Human, C-OFPSpark® tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat#STF01) transiently. After 48 h, the fluorescent signals can be detected by fluorescence microscope. Green excitation 475/40nm, emission 535/45nm. Red excitation 560/55nm, emission 645/45nm. Orange excitation 525/45nm, emission 595/60nm.

WT1 cDNA ORF Clone, Human, C-OFPSpark® tag: Alternative Names

AWT1 cDNA ORF Clone, Human; EWS-WT1 cDNA ORF Clone, Human; GUD cDNA ORF Clone, Human; NPHS4 cDNA ORF Clone, Human; WAGR cDNA ORF Clone, Human; WIT-2 cDNA ORF Clone, Human; WT33 cDNA ORF Clone, Human

WT1 Background Information

WT1 gene encodes a transcription factor that contains four zinc-finger motifs at the C-terminus and a proline/glutamine-rich DNA-binding domain at the N-terminus. It has an essential role in the normal development of the urogenital system, and it is mutated in a small subset of patients with Wilms tumor. This gene exhibits complex tissue-specific and polymorphic imprinting pattern, with biallelic, and monoallelic expression from the maternal and paternal alleles in different tissues. Multiple transcript variants have been described. In several variants, there is evidence for the use of a non-AUG (CUG) translation initiation codon upstream of, and in-frame with the first AUG.
Full Name
Wilms tumor 1
References
  • Niavarani A, Herold T, Reyal Y, et al. A 4‐gene expression score associated with high levels of Wilms Tumor‐1 (WT1) expression is an adverse prognostic factor in acute myeloid leukaemia. British Journal of Haematology. 2016;172(3):401-411.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait