TRAIL cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag tag

1/2
Price:
Size:
Number:

TRAIL cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
846 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 909C/T not causing the amino acid variation.
Description
Full length Clone DNA of Human tumor necrosis factor (ligand) superfamily, member 10 (TNFSF10) with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6kb + 0.93kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

TRAIL cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TRAIL cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.

TRAIL cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag tag: Alternative Names

Apo-2L cDNA ORF Clone, Human; APO2L cDNA ORF Clone, Human; CD253 cDNA ORF Clone, Human; TL2 cDNA ORF Clone, Human; TRAIL cDNA ORF Clone, Human

TRAIL Background Information

Tumor necrosis factor ligand superfamily member 1 (TNFSF1), also known as TNF-related apoptosis-inducing ligand (TRAIL), Apo-2 ligand, and CD253, is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. TNFSF1 / Apo-2L / CD253 functions as a ligand that induces the process of cell death called apoptosis. TNFSF1 / TRAIL shows homology to other members of the tumor necrosis factor superfamily. As one member of the cluster of differentiation system, TNFSF1 / CD253 is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 32 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion TNFSF1 / Apo-2L / CD253 / TRAIL binds to several members of TNF receptor superfamily including TNFRSF1A / TRAILR1, TNFRSF1B / TRAILR2, TNFRSF1C / TRAILR3, TNFRSF1D / TRAILR4, and possibly also to TNFRSF11B/OPG. The activity of TNFSF1 / TRAIL may be modulated by binding to the decoy receptors TNFRSF1C / TRAILR3, TNFRSF1D/TRAILR4, and TNFRSF11B/OPG that cannot induce apoptosis. The binding of this protein to its receptors has been shown to trigger the activation of MAPK8 / JNK, caspase 8, and caspase 3. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.
Full Name
tumor necrosis factor (ligand) superfamily, member 10
References
  • Song C, et al. (2005) TRAIL (CD253), a new member of the TNF superfamily. J Biol Regul Homeost Agents. 19(1-2): 73-7.
  • Kuribayashi K, et al. (2008) TNFSF10 (TRAIL), a p53 target gene that mediates p53-dependent cell death. Cancer Biol Ther. 7(12): 2034-8.
  • Wiley SR, et al. (1995) Identification and characterization of a new member of the TNF family that induces apoptosis. Immunity. 3(6): 673-82.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait