PSMC4 cDNA ORF Clone, Human, N-OFPSpark® tag

Price:
Size:
Number:

PSMC4 cDNA ORF Clone, Human, N-OFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1257 bp
Description
Full length Clone DNA of Human proteasome (prosome, macropain) 26S subunit, ATPase, 4 with N terminal OFPSpark / RFP tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PSMC4 cDNA ORF Clone, Human, N-OFPSpark® tag: Alternative Names

MIP224 cDNA ORF Clone, Human; RPT3 cDNA ORF Clone, Human; S6 cDNA ORF Clone, Human; TBP-7 cDNA ORF Clone, Human; TBP7 cDNA ORF Clone, Human

PSMC4 Background Information

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait