LC3B cDNA ORF Clone, Human, C-GFPSpark® tag

1/1
Price:
Size:
Number:

LC3B cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1107 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human microtubule associated protein 1 light chain 3 beta with C terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI(6kb+1.11kb)
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

LC3B cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LC3B cDNA ORF Clone, Human, C-GFPSpark® tag: Validated Images

LC3B cDNA ORF Clone, Human, C-GFPSpark® tag: Alternative Names

ATG8F cDNA ORF Clone, Human; LC3B cDNA ORF Clone, Human; MAP1A/1BLC3 cDNA ORF Clone, Human; MAP1LC3B-a cDNA ORF Clone, Human

LC3B Background Information

LC3B, also known as MAP1LC3B, is a member of the MAP1 LC3 family. It is moat abundantly expressed in heart, brain, skeletal muscle and testis. LC3B is a subunit of neuronal microtubule and functions in formation of autophagosomal vacuoles (autophagosomes). It associated MAP1A and MAP1B proteins, which are involved in microtubule assembly and important for neurogenesis. LC3B also plays a role in autophagy, a process that involves the bulk degradation of cytoplasmic component.
Full Name
microtubule-associated protein 1 light chain 3 beta
References
  • Behrends C. et al., 2010, Nature. 466 (7302): 68-76.
  • Tanida I. et al., 2005, Int J Biochem Cell Biol. 36 (12): 2503-18.
  • Kabeya Y. et al., 2000, EMBO J. 19 (21): 5720-8.
  • Cherra SJ. et al., 2010, J Cell Biol. 190 (4): 533-9.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait