ING1 cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag tag

Price:
Size:
Number:

ING1 cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
840 bp
Description
Full length Clone DNA of Human inhibitor of growth family, member 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

ING1 cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag tag: Alternative Names

p24ING1c cDNA ORF Clone, Human; p33 cDNA ORF Clone, Human; p33ING1 cDNA ORF Clone, Human; p33ING1b cDNA ORF Clone, Human; p47 cDNA ORF Clone, Human; p47ING1a cDNA ORF Clone, Human

ING1 Background Information

The ING1 gene is involved in the regulation of the cell cycle, senescence, and apoptosis and is a novel candidate tumor suppressor gene.Inhibitor of growth 1 (ING1) is implicated in oncogenesis, DNA damage repair, and apoptosis. Mutations within the ING1 gene and altered expression levels of ING1 are found in multiple human cancers.Overexpression of ING1 enhances expression of the Bax gene and was reported to alter mitochondrial membrane potential in a p53-dependent manner.
Full Name
inhibitor of growth family, member 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait