HSP90 cDNA ORF Clone, Human, C-OFPSpark® tag

1/1
Price:
Size:
Number:

HSP90 cDNA ORF Clone, Human, C-OFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2175 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 741A>G not causing the amino acid variation.
Description
Full length Clone DNA of Human heat shock protein 90kDa alpha (cytosolic), class B member 1 with C terminal OFPSpark / RFP tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI (two restriction sites) + XbaI (6kb + 2.33kb + 0.54kb)
Tag Sequence
OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

HSP90 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HSP90 cDNA ORF Clone, Human, C-OFPSpark® tag: Validated Images

HSP90 cDNA ORF Clone, Human, C-OFPSpark® tag: Alternative Names

D6S182 cDNA ORF Clone, Human; HSP84 cDNA ORF Clone, Human; HSP90B cDNA ORF Clone, Human; HSPC2 cDNA ORF Clone, Human; HSPCB cDNA ORF Clone, Human

HSP90 Background Information

Full Name
heat shock protein 90kDa alpha (cytosolic), class B member 1

HSP90 cDNA ORF Clone, Mouse, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait