After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек Coagulation Factor X/F10 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human F10 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_000504.3
Размер кДНК:1461bp
Описание кДНК:Full length Clone DNA of Homo sapiens coagulation factor X.
Синоним гена:F10, FX, FXA
Виды:Human
переносчик:pCMV/hygro
Plasmid:pCMV-F10
Участок рестрикции:HindIII + XbaI (5.5kb + 1.46kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence except for the point mutation: 792 C/T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human F10 Gene Plasmid Map
Human F10 / FX Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Человек Coagulation Factor X/F10 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек Coagulation Factor X/F10 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11076-ACGRBS15400
Человек Coagulation Factor X/F10 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11076-ACRRBS15400
Человек Coagulation Factor X/F10 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11076-ANGRBS15400
Человек Coagulation Factor X/F10 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11076-ANRRBS15400
Человек Coagulation Factor X/F10 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11076-CFRBS13340
Человек Coagulation Factor X/F10 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11076-CHRBS13340
Человек Coagulation Factor X/F10 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11076-CMRBS13340
Человек Coagulation Factor X/F10 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11076-CYRBS13340
Человек Coagulation Factor X/F10 Джин клон кДНК в вектор клонированияHG11076-GRBS5130
Человек Coagulation Factor X/F10 Джин ORF экспрессии кДНК клона плазмидыHG11076-G-NRBS13340
Человек Coagulation Factor X/F10 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11076-NFRBS13340
Человек Coagulation Factor X/F10 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11076-NHRBS13340
Человек Coagulation Factor X/F10 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11076-NMRBS13340
Человек Coagulation Factor X/F10 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11076-NYRBS13340
Человек Coagulation Factor X/F10 Джин ORF экспрессии кДНК клона плазмидыHG11076-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Coagulation factor X, also known as FX, F10, Eponym Stuart-Prower factor, and thrombokinase, is an enzyme of the coagulation cascade. It is one of the vitamin K-dependent serine proteases, and plays a crucial role in the coagulation cascade and blood clotting, as the first enzyme in the common pathway of thrombus formation. Factor X deficiency is one of the rarest of the inherited coagulation disorders. FX deficiency among the most severe of the rare coagulation defects, typically including hemarthroses, hematomas, and umbilical cord, gastrointestinal, and central nervous system bleeding. Factor X is synthesized in the liver as a mature heterodimer formed from a single-chain precursor, and vitamin K is essential for its synthesis. Factor X is activated into factor Xa (FXa) by both factor IX (with its cofactor, factor VIII in a complex known as intrinsic Xase) and factor VII (with its cofactor, tissue factor in a complex known as extrinsic Xase) through cleaving the activation propeptide. As the first member of the final common pathway or thrombin pathway, FXa converts prothrombin to thrombin in the presence of factor Va, Ca2+, and phospholipid during blood clotting and cleaves prothrombin in two places (an arg-thr and then an arg-ile bond). This process is optimized when factor Xa is complexed with activated cofactor V in the prothrombinase complex. Inborn deficiency of factor X is very uncommon, and may present with epistaxis (nose bleeds), hemarthrosis (bleeding into joints) and gastrointestinal blood loss. Apart from congenital deficiency, low factor X levels may occur occasionally in a number of disease states. Furhermore, factor X deficiency may be seen in amyloidosis, where factor X is adsorbed to the amyloid fibrils in the vasculature.

Ссылки
  • Rosen ED. (2002) Gene targeting in hemostasis. Factor X. Front Biosci. 7: d1915-25.
  • Uprichard J, et al. (2002) Factor X deficiency. Blood Rev. 16(2): 97-110.
  • Borensztajn K, et al. (2008) Factor Xa: at the crossroads between coagulation and signaling in physiology and disease. Trends Mol Med. 14(10): 429-40.
  • Menegatti M, et al. (2009) Factor X deficiency. Semin Thromb Hemost. 35(4): 407-15.
  • Size / Price
    Каталог: HG11076-G-N
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Human F10 / FX Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».