CDK9/CDC2L4 cDNA ORF Clone, Human, C-Myc tag

Price:
Size:
Number:

CDK9/CDC2L4 cDNA ORF Clone, Human, C-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1118 bp
Description
Full length Clone DNA of Human cyclin-dependent kinase 9 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CDK9/CDC2L4 cDNA ORF Clone, Human, C-Myc tag: Alternative Names

C-2k cDNA ORF Clone, Human; CDC2L4 cDNA ORF Clone, Human; CTK1 cDNA ORF Clone, Human; PITALRE cDNA ORF Clone, Human; TAK cDNA ORF Clone, Human

CDK9/CDC2L4 Background Information

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait