ATG12 cDNA ORF Clone, Human, C-OFPSpark® tag

1/1
Price:
Size:
Number:

ATG12 cDNA ORF Clone, Human, C-OFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
564 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human ATG12 autophagy related 12 homolog (S. cerevisiae) with C terminal OFPSpark / RFP tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6kb + 1.25kb)
Tag Sequence
OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ATG12 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ATG12 cDNA ORF Clone, Human, C-OFPSpark® tag: Validated Images

ATG12 cDNA ORF Clone, Human, C-OFPSpark® tag: Alternative Names

APG12 cDNA ORF Clone, Human; APG12L cDNA ORF Clone, Human; FBR93 cDNA ORF Clone, Human; HAPG12 cDNA ORF Clone, Human

ATG12 Background Information

autophagy-related protein 12 (ATG12) was a downstream protein that Ambra1 regulated EPI-induced autophagy. Therefore, Ambra1 plays an important role in regulating the sensitivity of breast cancer cells to EPI. And the regulatory effect of Ambra1 on EPI sensitivity is achieved through the regulation of autophagy by targeting ATG12. ATG12 is a novel targeting protein of Ambra1 in regulating EPI-induced autophagy. The important role of Ambra1 in modulating the sensitivity of breast cancer cells to EPI is confirmed in vivo. The autophagic ubiquitin-like protein (ublp) autophagy-related (ATG)12 is a component of the ATG12 approximately ATG5-ATG16L1 E3 complex that promotes lipid conjugation of members of the LC3 ublp family.
Full Name
autophagy related 12
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait