ANGPTL2 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11014-M-F

This product is not available, please contact order@sinobiological.com for relevant product if required.

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All ANGPTL2 Reagents

CRO Services


All ANGPTL2 Reagents

ANGPTL2 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1482 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human angiopoietin-like 2 with Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
pCMV2-FLAG
Restriction Sites
HindIII + XhoI (5.4kb + 1.53kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ANGPTL2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ANGPTL2 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images

Human EG-VEGF / prokineticin-1 Gene Plasmid Map 7151

ANGPTL2 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names

ARP2 cDNA ORF Clone, Human;HARP cDNA ORF Clone, Human

ANGPTL2 Background Information

Full Name
angiopoietin-like 2

ANGPTL2 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
ANGPTL2 cDNA ORF Clone in Cloning Vector, Canine DG70033-G
ANGPTL2 cDNA ORF Clone, Canine, untagged DG70033-UT
ANGPTL2 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70033-ACG
ANGPTL2 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70033-ACGLN
ANGPTL2 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70033-ACR
ANGPTL2 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70033-CF
ANGPTL2 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70033-NF
ANGPTL2 cDNA ORF Clone, Canine, C-His tag DG70033-CH
ANGPTL2 cDNA ORF Clone, Canine, N-His tag DG70033-NH
ANGPTL2 cDNA ORF Clone, Canine, C-HA tag DG70033-CY
ANGPTL2 cDNA ORF Clone, Canine, N-HA tag DG70033-NY
ANGPTL2 cDNA ORF Clone, Canine, C-Myc tag DG70033-CM
ANGPTL2 cDNA ORF Clone, Canine, N-Myc tag DG70033-NM

ANGPTL2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ANGPTL2 cDNA ORF Clone in Cloning Vector, Rat RG81033-U
ANGPTL2 cDNA ORF Clone, Rat, untagged RG81033-UT
ANGPTL2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81033-ACG
ANGPTL2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81033-ACGLN
ANGPTL2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81033-ACR
ANGPTL2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81033-CF
ANGPTL2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81033-NF
ANGPTL2 cDNA ORF Clone, Rat, C-His tag RG81033-CH
ANGPTL2 cDNA ORF Clone, Rat, N-His tag RG81033-NH
ANGPTL2 cDNA ORF Clone, Rat, C-HA tag RG81033-CY
ANGPTL2 cDNA ORF Clone, Rat, N-HA tag RG81033-NY
ANGPTL2 cDNA ORF Clone, Rat, C-Myc tag RG81033-CM
ANGPTL2 cDNA ORF Clone, Rat, N-Myc tag RG81033-NM
ANGPTL2 qPCR Primer Pairs, Rat RP300997

ANGPTL2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ANGPTL2 cDNA ORF Clone in Cloning Vector, Mouse MG50301-M
ANGPTL2 cDNA ORF Clone, Mouse, untagged MG50301-UT
ANGPTL2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50301-ACGLN
ANGPTL2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50301-ACG
ANGPTL2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50301-ACR
ANGPTL2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50301-CF
ANGPTL2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50301-NF
ANGPTL2 cDNA ORF Clone, Mouse, C-His tag MG50301-CH
ANGPTL2 cDNA ORF Clone, Mouse, N-His tag MG50301-NH
ANGPTL2 cDNA ORF Clone, Mouse, C-HA tag MG50301-CY
ANGPTL2 cDNA ORF Clone, Mouse, N-HA tag MG50301-NY
ANGPTL2 cDNA ORF Clone, Mouse, C-Myc tag MG50301-CM
ANGPTL2 cDNA ORF Clone, Mouse, N-Myc tag MG50301-NM
ANGPTL2 qPCR Primer Pairs, Mouse MP200324

ANGPTL2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ANGPTL2 cDNA ORF Clone in Cloning Vector, Human HG11014-M
ANGPTL2 cDNA ORF Clone, Human, untagged HG11014-UT
ANGPTL2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11014-ACGLN
ANGPTL2 cDNA ORF Clone, Human, C-GFPSpark® tag HG11014-ACG
ANGPTL2 cDNA ORF Clone, Human, C-OFPSpark® tag HG11014-ACR
ANGPTL2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11014-CF
ANGPTL2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11014-NF
ANGPTL2 cDNA ORF Clone, Human, C-His tag HG11014-CH
ANGPTL2 cDNA ORF Clone, Human, N-His tag HG11014-NH
ANGPTL2 cDNA ORF Clone, Human, C-HA tag HG11014-CY
ANGPTL2 cDNA ORF Clone, Human, N-HA tag HG11014-NY
ANGPTL2 cDNA ORF Clone, Human, C-Myc tag HG11014-CM
ANGPTL2 cDNA ORF Clone, Human, N-Myc tag HG11014-NM
ANGPTL2 qPCR Primer Pairs, Human HP100975
info info
添加购物车成功! 添加购物车失败!