Fas Ligand Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

Fas Ligand Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
846 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Homo sapiens Fas ligand (TNF superfamily, member 6).
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

Fas Ligand Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Alternative Names

ALPS1B cDNA ORF Clone, Human; APT1LG1 cDNA ORF Clone, Human; APTL cDNA ORF Clone, Human; CD178 cDNA ORF Clone, Human; CD95-L cDNA ORF Clone, Human; CD95L cDNA ORF Clone, Human; FASL cDNA ORF Clone, Human; FASLG cDNA ORF Clone, Human; TNFSF6 cDNA ORF Clone, Human; TNLG1A cDNA ORF Clone, Human

Fas Ligand Background Information

Fas Ligand, also known as FASLG and CD95L, is the ligand for FAS. It is a transmembrane protein which binds to TNFRSF6/FAS. Interaction of FAS with fas Ligand is critical in triggering apoptosis of some types of cells such as lymphocytes. Fas Ligand may be involved in cytotoxic T-cell mediated apoptosis and in T-cell development. TNFRSF6/FAS-mediated apoptosis may have a role in the induction of peripheral tolerance, in the antigen-stimulated suicide of mature T-cells, or both.
Full Name
Fas ligand
References
  • Pitti R M. et al., 1998, Nature. 396 (6712): 699-703.
  • Hane M. et al., 1995, FEBS Lett. 373 (3): 265-8.
  • Schneider P. et al., 1997, J Biol Chem. 272 (30): 18827-33.

Fas Ligand cDNA ORF Clone, Cynomolgus, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait