Endoglin / CD105 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

Endoglin / CD105 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1959 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Mus musculus endoglin, transcript variant 3.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

Endoglin / CD105 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: Alternative Names

AI528660 cDNA ORF Clone, Mouse; AI662476 cDNA ORF Clone, Mouse; CD105 cDNA ORF Clone, Mouse; Endo cDNA ORF Clone, Mouse; S-endoglin cDNA ORF Clone, Mouse

Endoglin / CD105 Background Information

Endoglin, also known as CD15, is a type I homodimeric transmembrane glycoprotein with a large, disulfide-linked, extracellular region and a short, constitutively phosphorylated cytoplasmic tail. Endoglin contains an RGD tripeptide which is a key recognition structure in cellular adhesion,,suggesting a critical role for endoglin in the binding of endothelial cells to integrins and/or other RGD receptors. Endoglin is highly expressed on vascular endothelial cells, chondrocytes, and syncytiotrophoblasts of term placenta. It is also found on activated monocytes, mesenchymal stem cells and leukemic cells of lymphoid and myeloid lineages. As an accessory receptor for the TGF-β superfamily ligands, endoglin binds TGF-β1 and TGF-β3 with high affinity not by itself but by associating with TGF-β type II receptor (TβRII) and activates the downstream signal pathways. In addition, in human umbilical vein endothelial cells, ALK-1 is also a receptor kinase for endoglin threonine phosphorylation, and mutations in either of the two genes result in the autosomal-dominant vascular dysplasia, hereditary hemorrhagic telangiectasia (HHT). Endoglin has been regarded as a powerful biomarker of neovascularization, and is associated with several solid tumor types.
Full Name
endoglin
References
  • Bellon T., et al.,(1993), Identification and expression of two forms of the human transforming growth factor-beta-binding protein endoglin with distinct cytoplasmic regions. Eur. J. Immunol. 23:2340-2345.
  • Humphray S.J., et al., (2004), DNA sequence and analysis of human chromosome 9.Nature 429:369-374.
  • Gougos A., et al.,(1990), Primary structure of endoglin, an RGD-containing glycoprotein of human endothelial cells.J. Biol. Chem. 265:8361-8364.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait