After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Яванский макак CD38/ADPRC1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus CD38 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:unsubmitted
Размер кДНК:906bp
Описание кДНК:Full length Clone DNA of Macaca mulatta CD38 antigen DNA.
Синоним гена:CD38
Виды:Cynomolgus
переносчик:pCMV/hygro
Plasmid:pCMV-cynoCD38
Участок рестрикции:KpnI + XhoI
Последовательность меток:
Описание последовательности:Identical with XM_001104281.2 [ Macaca mulatta (Rhesus monkey) ] sequence. Please check the sequence information before order.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Cynomolgus CD38 Gene Plasmid Map
Cynomolgus monkey CD38 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Яванский макак CD38/ADPRC1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90050-ACGRBS15400
Яванский макак CD38/ADPRC1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90050-ACRRBS15400
Яванский макак CD38/ADPRC1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90050-CFRBS13340
Яванский макак CD38/ADPRC1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90050-CHRBS13340
Яванский макак CD38/ADPRC1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90050-CMRBS13340
Яванский макак CD38/ADPRC1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90050-CYRBS13340
Яванский макак CD38/ADPRC1 Джин клон кДНК в вектор клонированияCG90050-GRBS5130
Яванский макак CD38/ADPRC1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90050-NFRBS13340
Яванский макак CD38/ADPRC1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90050-NHRBS13340
Яванский макак CD38/ADPRC1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90050-NMRBS13340
Яванский макак CD38/ADPRC1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90050-NYRBS13340
Яванский макак CD38/ADPRC1 Джин ORF экспрессии кДНК клона плазмидыCG90050-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Cluster of differentiation 38 (CD38), also known as ADP-ribosyl cyclase, is a glycoprotein found on the surface of many immune cells (white blood cells), including CD4+, CD8+, B and natural killer cells. It shares several characteristics with ADP-ribosyl cyclase 2 CD157. CD38 is a multifunctional ectoenzyme that catalyzes the synthesis and hydrolysis of cyclic ADP-ribose (cADPR) from NAD+ to ADP-ribose. It also functions in cell adhesion, signal transduction and calcium signaling. CD38 has been used as a prognostic marker in leukemia. It can also be used to identify plasma cells.

Ссылки
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».