CXCR4/CD184 cDNA ORF Clone, Cynomolgus, untagged

1/1
Price:
Size:
Number:

CXCR4/CD184 cDNA ORF Clone, Cynomolgus, untagged: General Information

Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
1059 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Cynomolgus C-X-C motif chemokine receptor 4
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI(6.1kb+1.06kb)
Sequencing Primers
T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CXCR4/CD184 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CXCR4/CD184 cDNA ORF Clone, Cynomolgus, untagged: Validated Images

CXCR4/CD184 cDNA ORF Clone, Cynomolgus, untagged: Alternative Names

CXC-R4 cDNA ORF Clone, Cynomolgus; CXCR-4 cDNA ORF Clone, Cynomolgus; LESTR cDNA ORF Clone, Cynomolgus

CXCR4/CD184 Background Information

Full Name
chemokine (C-X-C motif) receptor 4
Research Areas
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait