ICOS Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag

Price:
Size:
Number:

ICOS Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
603 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Rattus norvegicus inducible T-cell co-stimulator.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

ICOS Background Information

Inducible costimulator (ICOS), also called AILIM (activiation-inducible lymphocyte immunomediatory molecule) is a cell-surface receptor, and belongs to the CD28 family of immune costimulatory receptors consisting of CD28, CTLA-4 and PD-1. The interaction of B7-H2/ICOS plays a critical role in Th cell differentiation, T−B cell interactions which is essential for germinal center formation, and humoral immune responses, and as well as the production of cytokine IL-4. In addition, ICOS is more potent in the induction of IL-1 production, a cytokine important for suppressive function of T regulatory cells. The B7-1/B7-2--CD28/CTLA-4 and ICOS-B7RP-1 pathway provides key second signals that can regulate the activation, inhibition and fine-tuning of T-lymphocyte responses. ICOS stimulates both Th1 and Th2 cytokine production but may have a preferential role in Th2 cell development. Moreover, The B7-1/B7-2-CD28/CTLA-4 and ICOS-B7RP-1 pathway has been suggested of being involved in the development of airway inflammation and airway hyperresponsiveness.
Full Name
inducible T-cell co-stimulator
References
  • Coyle AJ, et al. (2004) The role of ICOS and other costimulatory molecules in allergy and asthma. Springer Semin Immunopathol. 25(3-4): 349-59.
  • Chen YQ, et al. (2006) CD28/CTLA-4--CD80/CD86 and ICOS--B7RP-1 costimulatory pathway in bronchial asthma. Allergy. 61(1): 15-26.
  • van Berkel ME, et al. (2006) CD28 and ICOS: similar or separate costimulators of T cells Immunol Lett. 105(2): 115-22.

ICOS cDNA ORF Clone, Cynomolgus, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait