CD64 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

CD64 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1215 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Mus musculus Fc receptor, IgG, high affinity I.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

CD64 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: Alternative Names

AI323638 cDNA ORF Clone, Mouse; AV092959 cDNA ORF Clone, Mouse; CD64 cDNA ORF Clone, Mouse; FcgammaRI cDNA ORF Clone, Mouse; IGGHAFC cDNA ORF Clone, Mouse

CD64 Background Information

High affinity immunoglobulin gamma Fc receptor I, also known as FCGR1 and CD64, is an integral membraneglycoprotein and a member of the immunoglobulin superfamily. CD64 is a high affinity receptor for the Fc region of IgG gamma and functions in both innate and adaptive immune responses. Receptors that recognize the Fc portion of IgG function in the regulation of immune response and are divided into three classes designated CD64, CD32, and CD16. CD64 is structurally composed of asignal peptidethat allows its transport to the surface of a cell, threeextracellularimmunoglobulin domainsof the C2-type that it uses to bind antibody, a hydrophobictransmembrane domain, and a short cytoplasmic tail. CD64 isconstitutivelyfound on only macrophages and monocytes, but treatment of polymorphonuclear leukocyteswith cytokines likeIFNγandG-CSFcan induce CD64 expression on these cells. The inactivation of the mouse CD64 resulted in a wide range of defects in antibody Fc-dependent functions. Mouse CD64 is an early participant in Fc-dependent cell activation and in the development of immune responses.
Full Name
Fc receptor, IgG, high affinity I
References
  • Allen J.M., et al.,(1988), Nucleotide sequence of three cDNAs for the human high affinity Fc receptor (FcRI). Nucleic Acids Res. 16:11824-11824.
  • Allen J.M., et al., (1989), Isolation and expression of functional high-affinity Fc receptor complementary DNAs.Science 243:378-381.
  • Porges A.J., et al.,(1992), Novel Fc gamma receptor I family gene products in human mononuclear cells.J. Clin. Invest. 90:2102-2109.

CD64 cDNA ORF Clone, Human, Related Products

CD64 cDNA ORF Clone, Rat, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait