XPNPEP1 cDNA ORF Clone, Human, untagged

This product is not available, please contact order_us@sinobiological.com for relevant product if required.

XPNPEP1 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1872 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human X-prolyl aminopeptidase (aminopeptidase P) 1, soluble DNA.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro
Restriction Sites
KpnI + XbaI
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

XPNPEP1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

XPNPEP1 cDNA ORF Clone, Human, untagged: Alternative Names

APP1 cDNA ORF Clone, Human; SAMP cDNA ORF Clone, Human; XPNPEP cDNA ORF Clone, Human; XPNPEPL cDNA ORF Clone, Human; XPNPEPL1 cDNA ORF Clone, Human

XPNPEP1 Background Information

Full Name
X-prolyl aminopeptidase (aminopeptidase P) 1, soluble
Add to Cart Successfully Add to Cart Failed