West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, C-His tag

Cat: VG40344-CH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All WNV Capsid protein Reagents

CRO Services

Product recommended


All WNV Capsid protein Reagents

West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, C-His tag General Information

Gene

Species
WNV
NCBI Ref Seq
RefSeq ORF Size
315 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence DQ211652.1 (97..411), corresponding to amino acid sequence YP_001527878.1.
Description
Full length Clone DNA of West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

WNV Capsid protein Background Information

WNV Capsid protein cDNA ORF Clone, WNV, Related Products

Product Name Catalog#(PDF)
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid VG40344-G
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C natural ORF mammalian expression plasmid VG40344-UT
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, C-GFPSpark tag VG40344-ACG
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40344-ACGLN
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, N-GFPSpark tag VG40344-ANG
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40344-ACR
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, N-OFPSpark / RFP tag VG40344-ANR
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged VG40344-CF
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, N-Flag tag VG40344-NF
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, N-His tag VG40344-NH
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, C-HA tag VG40344-CY
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, N-HA tag VG40344-NY
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, C-Myc tag VG40344-CM
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, N-Myc tag VG40344-NM
info info
添加购物车成功! 添加购物车失败!