Быстрый заказ

Мышь VEGFC/VEGF-C/Flt4-L Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse VEGF-C Информация о продукте «Клон cDNA»
Размер кДНК:
Описание кДНК:
Синоним гена:
Участок рестрикции:
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref.ID sequence.
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Mouse VEGF-C Gene Plasmid Map
Mouse VEGF-C Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Мышь VEGFC/VEGF-C/Flt4-L Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50391-ACGRBS15400
Мышь VEGFC/VEGF-C/Flt4-L Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50391-ACRRBS15400
Мышь VEGFC/VEGF-C/Flt4-L Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50391-CFRBS13340
Мышь VEGFC/VEGF-C/Flt4-L Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50391-CHRBS13340
Мышь VEGFC/VEGF-C/Flt4-L Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50391-CMRBS13340
Мышь VEGFC/VEGF-C/Flt4-L Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50391-CYRBS13340
Мышь VEGFC/VEGF-C/Flt4-L Джин клон кДНК в вектор клонированияMG50391-MRBS5130
Мышь VEGFC/VEGF-C/Flt4-L Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50391-M-HRBS13340
Мышь VEGFC/VEGF-C/Flt4-L Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50391-NFRBS13340
Мышь VEGFC/VEGF-C/Flt4-L Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50391-NHRBS13340
Мышь VEGFC/VEGF-C/Flt4-L Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50391-NMRBS13340
Мышь VEGFC/VEGF-C/Flt4-L Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50391-NYRBS13340
Мышь VEGFC/VEGF-C/Flt4-L Джин ORF экспрессии кДНК клона плазмидыMG50391-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Vascular endothelial growth factor C (VEGF-C) is a member of the VEGF family. Upon biosynthesis, VEGF-C protein is secreted as a non-covalent momodimer in an anti-parellel fashion. VEGF-C protein is a dimeric glycoprotein, as a ligand for two receptors, VEGFR-3 (Flt4), and VEGFR-2. VEGF-C may function in angiogenesis of the venous and lymphatic vascular systems during embryogenesis. VEGF-C protein is over-expressed in various human cancers including breast cancer and prostate cancer. VEGF-C/VEGFR-3 axis, through different signaling pathways, plays a critical role in cancer progression by regulating different cellular functions, such as invasion, proliferation, and resistance to chemotherapy. Thus, targeting the VEGF-C/VEGFR-3 axis may be therapeutically significant for certain types of tumors.

  • Joukov V, et al. (1997) Vascular endothelial growth factors VEGF-B and VEGF-C. J Cell Physiol. 173(2): 211-5.
  • Su JL, et al. (2007) The role of the VEGF-C/VEGFR-3 axis in cancer progression. Br J Cancer. 96(4): 541-5.
  • Anisimov A, et al. (2009) Activated forms of VEGF-C and VEGF-D provide improved vascular function in skeletal muscle. Circ Res. 104(11): 1302-12.
  • Contact Us
    • Mouse VEGF-C Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.