After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек SIRT4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SIRT4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:
Размер кДНК:
Описание кДНК:
Синоним гена:
Виды:Human
переносчик:
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref.ID sequence.
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Склад:
Human SIRT4 Gene Plasmid Map
Human SIRT4 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV/hygro-FLAG Vector Information
 
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек SIRT4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13076-ACGRBS15400
Человек SIRT4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13076-ACRRBS15400
Человек SIRT4 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG13076-ANGRBS15400
Человек SIRT4 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG13076-ANRRBS15400
Человек SIRT4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13076-CFRBS13340
Человек SIRT4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13076-CHRBS13340
Человек SIRT4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13076-CMRBS13340
Человек SIRT4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13076-CYRBS13340
Человек SIRT4 Джин клон кДНК в вектор клонированияHG13076-GRBS5130
Человек SIRT4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13076-NFRBS13340
Человек SIRT4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13076-NHRBS13340
Человек SIRT4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13076-NMRBS13340
Человек SIRT4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13076-NYRBS13340
Человек SIRT4 Джин ORF экспрессии кДНК клона плазмидыHG13076-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Contact Us
Изображения
  • Human SIRT4 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
    Недавно просмотренные товары
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».