After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь SIRPA/SIRP alpha/CD172a Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse SIRPA Информация о продукте «Клон cDNA»
Gene_bank_ref_id:
Размер кДНК:
Описание кДНК:
Синоним гена:
Виды:Mouse
переносчик:
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence except for the point mutation 459 A/G not causing the amino acid variation.
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Склад:
Mouse SIRPA Gene Plasmid Map
Mouse SIRPA Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Мышь SIRPA/SIRP alpha/CD172a Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50956-ACGRBS16760
Мышь SIRPA/SIRP alpha/CD172a Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50956-ACRRBS16760
Мышь SIRPA/SIRP alpha/CD172a Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50956-CFRBS14710
Мышь SIRPA/SIRP alpha/CD172a Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50956-CHRBS14710
Мышь SIRPA/SIRP alpha/CD172a Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50956-CMRBS14710
Мышь SIRPA/SIRP alpha/CD172a Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50956-CYRBS14710
Мышь SIRPA/SIRP alpha/CD172a Джин клон кДНК в вектор клонированияMG50956-GRBS5130
Мышь SIRPA/SIRP alpha/CD172a Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50956-NFRBS14710
Мышь SIRPA/SIRP alpha/CD172a Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50956-NHRBS14710
Мышь SIRPA/SIRP alpha/CD172a Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50956-NMRBS14710
Мышь SIRPA/SIRP alpha/CD172a Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50956-NYRBS14710
Мышь SIRPA/SIRP alpha/CD172a Джин ORF экспрессии кДНК клона плазмидыMG50956-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Tyrosine-protein phosphatase non-receptor type substrate 1, also known as SHP substrate 1, Inhibitory receptor SHPS-1, Brain Ig-like molecule with tyrosine-based activation motifs, Macrophage fusion receptor, CD172 antigen-like family member A, SIRPA and CD172a, is a single-pass type I membrane protein which contains two Ig-like C1-type (immunoglobulin-like) domains and one Ig-like V-type (immunoglobulin-like) domain. SIRPA is ubiquitously expressed. It is highly expressed in brain and detected at lower levels in heart, placenta, lung, testis, ovary, colon, liver, small intestine, prostate, spleen, kidney, skeletal muscle and pancreas. It is also detected on myeloid cells, but not T-cells. SIRPA is an immunoglobulin-like cell surface receptor for CD47. SIRPA acts as docking protein and induces translocation of PTPN6, PTPN11 and other binding partners from the cytosol to the plasma membrane. SIRPA supports adhesion of cerebellar neurons, neurite outgrowth and glial cell attachment. It may play a key role in intracellular signaling during synaptogenesis and in synaptic function. SIRPA is involved in the negative regulation of receptor tyrosine kinase-coupled cellular responses induced by cell adhesion, growth factors or insulin. It mediates negative regulation of phagocytosis, mast cell activation and dendritic cell activation.

Ссылки
  • Timms JF. et al., 1999, Curr Biol. 9: 927-30.
  • Stofega MR. et al., 2000, J Biol Chem. 275: 28222-9.
  • Liu T. et al., 2005, J Proteome Res. 4: 2070-80.
  • Wolf-Yadlin A. et al., 2007, Proc Natl Acad Sci. 104: 5860-5.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».