Быстрый заказ

Крыса YWHAZ Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса YWHAZ Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC094305.1
    Размер кДНК:738bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide.
    Синоним гена:14-3-3z
    Виды:Rat
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with YWHAZ qPCR primers for gene expression analysis, RP301009 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Крыса YWHAZ Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Крыса YWHAZ Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81045-ACGRBS15400
    Крыса YWHAZ Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81045-ACRRBS15400
    Крыса YWHAZ Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81045-ANGRBS15400
    Крыса YWHAZ Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81045-ANRRBS15400
    Крыса YWHAZ Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81045-CFRBS13340
    Крыса YWHAZ Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81045-CHRBS13340
    Крыса YWHAZ Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81045-CMRBS13340
    Крыса YWHAZ Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81045-CYRBS13340
    Крыса YWHAZ Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81045-NFRBS13340
    Крыса YWHAZ Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81045-NHRBS13340
    Крыса YWHAZ Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81045-NMRBS13340
    Крыса YWHAZ Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81045-NYRBS13340
    Крыса YWHAZ Джин клон кДНК в вектор клонированияRG81045-URBS5130
    Крыса YWHAZ Джин ORF экспрессии кДНК клона плазмидыRG81045-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: RG81045-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».