Быстрый заказ

Крыса YIF1A Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса YIF1A Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_172017.2
    Размер кДНК:882bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus Yip1 interacting factor homolog A (S. cerevisiae).
    Синоним гена:Yif1, Yif1p
    Виды:Rat
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with YIF1A qPCR primers for gene expression analysis, RP300988 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Крыса YIF1A Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Крыса YIF1A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81024-ACGRBS15400
    Крыса YIF1A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81024-ACRRBS15400
    Крыса YIF1A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81024-CFRBS13340
    Крыса YIF1A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81024-CHRBS13340
    Крыса YIF1A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81024-CMRBS13340
    Крыса YIF1A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81024-CYRBS13340
    Крыса YIF1A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81024-NFRBS13340
    Крыса YIF1A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81024-NHRBS13340
    Крыса YIF1A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81024-NMRBS13340
    Крыса YIF1A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81024-NYRBS13340
    Крыса YIF1A Джин клон кДНК в вектор клонированияRG81024-URBS5130
    Крыса YIF1A Джин ORF экспрессии кДНК клона плазмидыRG81024-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: RG81024-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».