After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса YIF1A Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat YIF1A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_172017.2
Размер кДНК:882bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus Yip1 interacting factor homolog A (S. cerevisiae).
Синоним гена:Yif1, Yif1p
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса YIF1A Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса YIF1A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81024-ACGRBS15400
Крыса YIF1A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81024-ACRRBS15400
Крыса YIF1A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81024-CFRBS13340
Крыса YIF1A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81024-CHRBS13340
Крыса YIF1A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81024-CMRBS13340
Крыса YIF1A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81024-CYRBS13340
Крыса YIF1A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81024-NFRBS13340
Крыса YIF1A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81024-NHRBS13340
Крыса YIF1A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81024-NMRBS13340
Крыса YIF1A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81024-NYRBS13340
Крыса YIF1A Джин клон кДНК в вектор клонированияRG81024-URBS5130
Крыса YIF1A Джин ORF экспрессии кДНК клона плазмидыRG81024-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81024-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».