WDR12 cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Cat: RG81068-NF

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All WDR12 Reagents

CRO Services

Product recommended


All WDR12 Reagents

WDR12 cDNA ORF Clone, Rat, N-DDK (Flag®) tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1272 bp
Description
Full length Clone DNA of Rat WD repeat domain 12 with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

WDR12 Background Information

Full Name
WD repeat domain 12

WDR12 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
WDR12 cDNA ORF Clone in Cloning Vector, Rat RG81068-U
WDR12 cDNA ORF Clone, Rat, untagged RG81068-UT
WDR12 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81068-ACGLN
WDR12 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81068-ACG
WDR12 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81068-ANG
WDR12 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81068-ACR
WDR12 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81068-ANR
WDR12 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81068-CF
WDR12 cDNA ORF Clone, Rat, C-His tag RG81068-CH
WDR12 cDNA ORF Clone, Rat, N-His tag RG81068-NH
WDR12 cDNA ORF Clone, Rat, C-HA tag RG81068-CY
WDR12 cDNA ORF Clone, Rat, N-HA tag RG81068-NY
WDR12 cDNA ORF Clone, Rat, C-Myc tag RG81068-CM
WDR12 cDNA ORF Clone, Rat, N-Myc tag RG81068-NM
WDR12 qPCR Primer Pairs, Rat RP301032

WDR12 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
WDR12 cDNA ORF Clone in Cloning Vector, Mouse MG51802-G
WDR12 cDNA ORF Clone, Mouse, untagged MG51802-UT
WDR12 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51802-ACG
WDR12 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51802-ACGLN
WDR12 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51802-ANG
WDR12 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51802-ACR
WDR12 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51802-ANR
WDR12 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51802-CF
WDR12 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51802-NF
WDR12 cDNA ORF Clone, Mouse, C-His tag MG51802-CH
WDR12 cDNA ORF Clone, Mouse, N-His tag MG51802-NH
WDR12 cDNA ORF Clone, Mouse, C-HA tag MG51802-CY
WDR12 cDNA ORF Clone, Mouse, N-HA tag MG51802-NY
WDR12 cDNA ORF Clone, Mouse, C-Myc tag MG51802-CM
WDR12 cDNA ORF Clone, Mouse, N-Myc tag MG51802-NM
WDR12 qPCR Primer Pairs, Mouse MP201675

WDR12 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
WDR12 cDNA ORF Clone in Cloning Vector, Human HG22656-U
WDR12 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG22656-ACGLN
info info
添加购物车成功! 添加购物车失败!