After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса VPS25 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat VPS25 Информация о продукте «Клон cDNA»
Размер кДНК:531bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus vacuolar protein sorting 25 homolog (S. cerevisiae) with N terminal Flag tag.
Синоним гена:Vps25
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса VPS25 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Крыса VPS25 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81624-ACGRBS15400
Крыса VPS25 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81624-ACRRBS15400
Крыса VPS25 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81624-ANGRBS15400
Крыса VPS25 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81624-ANRRBS15400
Крыса VPS25 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81624-CFRBS13340
Крыса VPS25 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81624-CHRBS13340
Крыса VPS25 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81624-CMRBS13340
Крыса VPS25 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81624-CYRBS13340
Крыса VPS25 Джин клон кДНК в вектор клонированияRG81624-GRBS5130
Крыса VPS25 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81624-NFRBS13340
Крыса VPS25 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81624-NHRBS13340
Крыса VPS25 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81624-NMRBS13340
Крыса VPS25 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81624-NYRBS13340
Крыса VPS25 Джин ORF экспрессии кДНК клона плазмидыRG81624-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81624-NF
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.