After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Крыса VCAM1/VCAM-1/CD106 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat VCAM1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_012889.1
Размер кДНК:2220bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus vascular cell adhesion molecule 1.
Синоним гена:VCAM1B, MGC108734, Vcam1
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса VCAM1/VCAM-1/CD106 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса VCAM1/VCAM-1/CD106 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80233-ACGRBS16764
Крыса VCAM1/VCAM-1/CD106 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80233-ACRRBS16760
Крыса VCAM1/VCAM-1/CD106 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80233-CFRBS14711
Крыса VCAM1/VCAM-1/CD106 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80233-CHRBS14711
Крыса VCAM1/VCAM-1/CD106 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80233-CMRBS14711
Крыса VCAM1/VCAM-1/CD106 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80233-CYRBS14711
Крыса VCAM1/VCAM-1/CD106 Джин клон кДНК в вектор клонированияRG80233-GRBS5132
Крыса VCAM1/VCAM-1/CD106 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80233-NFRBS14711
Крыса VCAM1/VCAM-1/CD106 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80233-NHRBS14711
Крыса VCAM1/VCAM-1/CD106 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80233-NMRBS14711
Крыса VCAM1/VCAM-1/CD106 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80233-NYRBS14711
Крыса VCAM1/VCAM-1/CD106 Джин ORF экспрессии кДНК клона плазмидыRG80233-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Vascular cell adhesion molecule 1 (VCAM-1), also known as CD106, is a cell surface sialoglycoprotein belonging to the immunoglobulin superfamily. Two forms of VCAM-1 with either six or seven extracellular Ig-like domains are generated by alternative splicing, with the longer form predominant. VCAM-1 is an endothelial ligand for very late antigen-4 (VLA-4) and α4ß7 integrin expressed on leukocytes, and thus mediates leukocyte-endothelial cell adhesion and signal transduction. VCAM-1 expression is induced on endothelial cells during inflammatory bowel disease, atherosclerosis, allograft rejection, infection, and asthmatic responses. During these responses, VCAM-1 forms a scaffold for leukocyte migration. VCAM-1 also activates signals within endothelial cells resulting in the opening of an "endothelial cell gate" through which leukocytes migrate. VCAM-1 has been identified as a potential anti-inflammatory therapeutic target, the hypothesis being that reduced expression of VCAM-1 will slow the development of atherosclerosis. In addition, VCAM-1-activated signals in endothelial cells are regulated by cytokines indicating that it is important to consider both endothelial cell adhesion molecule expression and function during inflammatory processes.

Ссылки
  • Cook-Mills JM. (2002) VCAM-1 signals during lymphocyte migration: role of reactive oxygen species. Mol Immunol. 39(9): 499-508.
  • Preiss DJ, et al. (2007) Vascular cell adhesion molecule-1: a viable therapeutic target for atherosclerosis? Int J Clin Pract. 61(4): 697-701.
  • Size / Price
    Каталог: RG80233-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».