After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса UMPS Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat UMPS Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001025402.1
Размер кДНК:1446bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus uridine monophosphate synthetase.
Синоним гена:Umps
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса UMPS Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса UMPS Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81051-ACGRBS15400
Крыса UMPS Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81051-ACRRBS15400
Крыса UMPS Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81051-ANGRBS15400
Крыса UMPS Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81051-ANRRBS15400
Крыса UMPS Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81051-CFRBS13340
Крыса UMPS Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81051-CHRBS13340
Крыса UMPS Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81051-CMRBS13340
Крыса UMPS Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81051-CYRBS13340
Крыса UMPS Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81051-NFRBS13340
Крыса UMPS Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81051-NHRBS13340
Крыса UMPS Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81051-NMRBS13340
Крыса UMPS Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81051-NYRBS13340
Крыса UMPS Джин клон кДНК в вектор клонированияRG81051-URBS5130
Крыса UMPS Джин ORF экспрессии кДНК клона плазмидыRG81051-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81051-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».