Быстрый заказ

Text Size:AAA

Крыса UBE2G2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat UBE2G2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001106380.1
Размер кДНК:498bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus ubiquitin-conjugating enzyme E2G 2 with N terminal His tag.
Синоним гена:Ube2g2
Виды:Rat
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Крыса UBE2G2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Крыса UBE2G2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81636-ACGRBS15400
Крыса UBE2G2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81636-ACRRBS15400
Крыса UBE2G2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81636-ANGRBS15400
Крыса UBE2G2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81636-ANRRBS15400
Крыса UBE2G2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81636-CFRBS13340
Крыса UBE2G2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81636-CHRBS13340
Крыса UBE2G2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81636-CMRBS13340
Крыса UBE2G2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81636-CYRBS13340
Крыса UBE2G2 Джин клон кДНК в вектор клонированияRG81636-GRBS5130
Крыса UBE2G2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81636-NFRBS13340
Крыса UBE2G2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81636-NHRBS13340
Крыса UBE2G2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81636-NMRBS13340
Крыса UBE2G2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81636-NYRBS13340
Крыса UBE2G2 Джин ORF экспрессии кДНК клона плазмидыRG81636-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81636-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».