Быстрый заказ

Крыса TVP23B Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat TVP23B Информация о продукте «Клон cDNA»
Размер кДНК:618bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus trans-golgi network vesicle protein 23 homolog B (S. cerevisiae) with N terminal Flag tag.
Синоним гена:Fam18b2
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса TVP23B Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Крыса TVP23B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81329-ACGRBS15400
Крыса TVP23B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81329-ACRRBS15400
Крыса TVP23B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81329-CFRBS13340
Крыса TVP23B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81329-CHRBS13340
Крыса TVP23B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81329-CMRBS13340
Крыса TVP23B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81329-CYRBS13340
Крыса TVP23B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81329-NFRBS13340
Крыса TVP23B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81329-NHRBS13340
Крыса TVP23B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81329-NMRBS13340
Крыса TVP23B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81329-NYRBS13340
Крыса TVP23B Джин клон кДНК в вектор клонированияRG81329-URBS5130
Крыса TVP23B Джин ORF экспрессии кДНК клона плазмидыRG81329-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.