Быстрый заказ

Крыса TUBA1B Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat TUBA1B Информация о продукте «Клон cDNA»
Размер кДНК:1356bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus tubulin, alpha 1B with C terminal Myc tag.
Синоним гена:RGD1565476
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Крыса TUBA1B Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Крыса TUBA1B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81153-ACGRBS15400
Крыса TUBA1B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81153-ACRRBS15400
Крыса TUBA1B Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81153-ANGRBS15400
Крыса TUBA1B Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81153-ANRRBS15400
Крыса TUBA1B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81153-CFRBS13340
Крыса TUBA1B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81153-CHRBS13340
Крыса TUBA1B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81153-CMRBS13340
Крыса TUBA1B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81153-CYRBS13340
Крыса TUBA1B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81153-NFRBS13340
Крыса TUBA1B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81153-NHRBS13340
Крыса TUBA1B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81153-NMRBS13340
Крыса TUBA1B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81153-NYRBS13340
Крыса TUBA1B Джин клон кДНК в вектор клонированияRG81153-URBS5130
Крыса TUBA1B Джин ORF экспрессии кДНК клона плазмидыRG81153-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81153-CM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.