Быстрый заказ

Крыса TUBA1B Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса TUBA1B Информация о продукте «Клон cDNA»
    Размер кДНК:1356bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus tubulin, alpha 1B with C terminal Flag tag.
    Синоним гена:RGD1565476
    Участок рестрикции:
    Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Описание последовательности:
    ( We provide with TUBA1B qPCR primers for gene expression analysis, RP301109 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Крыса TUBA1B Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
    Крыса TUBA1B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81153-ACGRBS15400
    Крыса TUBA1B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81153-ACRRBS15400
    Крыса TUBA1B Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81153-ANGRBS15400
    Крыса TUBA1B Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81153-ANRRBS15400
    Крыса TUBA1B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81153-CFRBS13340
    Крыса TUBA1B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81153-CHRBS13340
    Крыса TUBA1B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81153-CMRBS13340
    Крыса TUBA1B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81153-CYRBS13340
    Крыса TUBA1B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81153-NFRBS13340
    Крыса TUBA1B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81153-NHRBS13340
    Крыса TUBA1B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81153-NMRBS13340
    Крыса TUBA1B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81153-NYRBS13340
    Крыса TUBA1B Джин клон кДНК в вектор клонированияRG81153-URBS5130
    Крыса TUBA1B Джин ORF экспрессии кДНК клона плазмидыRG81153-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: RG81153-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.