After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса Prealbumin/Transthyretin Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat TTR Информация о продукте «Клон cDNA»
Gene_bank_ref_id:AF479660.1
Размер кДНК:444bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus transthyretin with N terminal Myc tag.
Синоним гена:Lr1, Tbpa
Виды:Rat
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Крыса Prealbumin/Transthyretin Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Крыса Prealbumin/Transthyretin Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80728-ACGRBS15400
Крыса Prealbumin/Transthyretin Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80728-ACRRBS15396
Крыса Prealbumin/Transthyretin Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80728-CFRBS13340
Крыса Prealbumin/Transthyretin Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80728-CHRBS13340
Крыса Prealbumin/Transthyretin Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80728-CMRBS13340
Крыса Prealbumin/Transthyretin Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80728-CYRBS13340
Крыса Prealbumin/Transthyretin Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80728-NFRBS13340
Крыса Prealbumin/Transthyretin Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80728-NHRBS13340
Крыса Prealbumin/Transthyretin Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80728-NMRBS13340
Крыса Prealbumin/Transthyretin Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80728-NYRBS13340
Крыса Prealbumin/Transthyretin Джин клон кДНК в вектор клонированияRG80728-URBS5130
Крыса Prealbumin/Transthyretin Джин ORF экспрессии кДНК клона плазмидыRG80728-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Prealbumin/Transthyretin, also known as ATTR, Prealbumin, TTR and PALB, is a secreted and cytoplasm protein which belongs to the Prealbumin / Transthyretin family. Prealbumin / Transthyretin is detected in serum and cerebrospinal fluid (at protein level). It is highly expressed in choroid plexus epithelial cells. It is also detected in retina pigment epithelium and liver. Each monomer of Prealbumin / Transthyretin has two 4-stranded beta sheets and the shape of a prolate ellipsoid. Antiparallel beta-sheet interactions link monomers into dimers. A short loop from each monomer forms the main dimer-dimer interaction. These two pairs of loops separate the opposed, convex beta-sheets of the dimers to form an internal channel. Prealbumin/Transthyretin is a carrier protein. It transports thyroid hormones in the plasma and cerebrospinal fluid, and also transports retinol (vitamin A) in the plasma. Defects in Prealbumin / Transthyretin are the cause of amyloidosis type 1 (AMYL1) which is a hereditary generalized amyloidosis due to Prealbumin / Transthyretin amyloid deposition. Protein fibrils can form in different tissues leading to amyloid polyneuropathies, amyloidotic cardiomyopathy, carpal tunnel syndrome, systemic senile amyloidosis. The diseases caused by mutations include amyloidotic polyneuropathy, euthyroid hyperthyroxinaemia, amyloidotic vitreous opacities, cardiomyopathy, oculoleptomeningeal amyloidosis, meningocerebrovascular amyloidosis, carpal tunnel syndrome, etc.

Ссылки
  • Westermark P, et al. (1990) Fibril in senile systemic amyloidosis is derived from normal transthyretin. Proc Natl Acad Sci U S A. 87(7): 2843-5.
  • Colon W, et al. (1992) Partial denaturation of transthyretin is sufficient for amyloid fibril formation in vitro. Biochemistry. 31(36): 8654-60.
  • Hammarstrm P, et al. (2003) Prevention of transthyretin amyloid disease by changing protein misfolding energetics. Science. 299(5607): 713-6.
  • Size / Price
    Каталог: RG80728-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».