Быстрый заказ

Крыса TTC33 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса TTC33 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001106414.1
    Размер кДНК:789bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus tetratricopeptide repeat domain 33 with N terminal HA tag.
    Синоним гена:RGD1564042
    Виды:Rat
    переносчик:pCMV3-N-HA
    Plasmid:
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with TTC33 qPCR primers for gene expression analysis, RP300453 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Крыса TTC33 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
    Крыса TTC33 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80489-ACGRBS15400
    Крыса TTC33 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80489-ACRRBS15400
    Крыса TTC33 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG80489-ANGRBS15400
    Крыса TTC33 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG80489-ANRRBS15400
    Крыса TTC33 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80489-CFRBS13340
    Крыса TTC33 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80489-CHRBS13340
    Крыса TTC33 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80489-CMRBS13340
    Крыса TTC33 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80489-CYRBS13340
    Крыса TTC33 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80489-NFRBS13340
    Крыса TTC33 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80489-NHRBS13340
    Крыса TTC33 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80489-NMRBS13340
    Крыса TTC33 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80489-NYRBS13340
    Крыса TTC33 Джин клон кДНК в вектор клонированияRG80489-URBS5130
    Крыса TTC33 Джин ORF экспрессии кДНК клона плазмидыRG80489-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: RG80489-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».