Быстрый заказ

Крыса TALLA-1 / TSPAN7 (CD231) Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat TSPAN7 Информация о продукте «Клон cDNA»
Размер кДНК:750bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus tetraspanin 7 with C terminal HA tag.
Синоним гена:A15, MXS1, Tm4sf2, TALLA-1, DXS1692E, Tspan7
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса TALLA-1 / TSPAN7 (CD231) Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Крыса TALLA-1 / TSPAN7 (CD231) Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80372-ACGRBS15400
Крыса TALLA-1 / TSPAN7 (CD231) Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80372-ACRRBS15400
Крыса TALLA-1 / TSPAN7 (CD231) Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80372-CFRBS13340
Крыса TALLA-1 / TSPAN7 (CD231) Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80372-CHRBS13340
Крыса TALLA-1 / TSPAN7 (CD231) Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80372-CMRBS13340
Крыса TALLA-1 / TSPAN7 (CD231) Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80372-CYRBS13340
Крыса TALLA-1 / TSPAN7 (CD231) Джин клон кДНК в вектор клонированияRG80372-GRBS5130
Крыса TALLA-1 / TSPAN7 (CD231) Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80372-NFRBS13340
Крыса TALLA-1 / TSPAN7 (CD231) Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80372-NHRBS13340
Крыса TALLA-1 / TSPAN7 (CD231) Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80372-NMRBS13340
Крыса TALLA-1 / TSPAN7 (CD231) Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80372-NYRBS13340
Крыса TALLA-1 / TSPAN7 (CD231) Джин ORF экспрессии кДНК клона плазмидыRG80372-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

TALLA-1, also known as TSPAN7, is a member of the transmembrane 4 superfamily Most members of this family are cell-surface proteins that are characterized by the presence of four hydrophobic domains. TALLA-1 gene is associated with X-linked mental retardation and neuropsychiatric diseases such as Huntington's chorea, fragile X syndrome and myotonic dystrophy. TALLA-1 is a cell surface glycoprotein and may have a role in the control of neurite outgrowth. It is known to complex with integrins.

  • Berditchevski F. 2002, J Cell Sci. 114 (23): 4143-51.
  • Castellví-Bel S. et al., 2001, Mol Genet Metab. 72 (2): 104-8.
  • Abidi FE. et al., 2002, J Med Genet. 39 (6): 430-3.
  • Size / Price
    Каталог: RG80372-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.