Быстрый заказ

Text Size:AAA

Крыса TSPAN31 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat TSPAN31 Информация о продукте «Клон cDNA»
Размер кДНК:633bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus tetraspanin 31 with C terminal Flag tag.
Синоним гена:Sas
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса TSPAN31 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Крыса TSPAN31 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81110-ACGRBS15396
Крыса TSPAN31 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81110-ACRRBS15396
Крыса TSPAN31 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81110-CFRBS13343
Крыса TSPAN31 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81110-CHRBS13343
Крыса TSPAN31 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81110-CMRBS13343
Крыса TSPAN31 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81110-CYRBS13343
Крыса TSPAN31 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81110-NFRBS13343
Крыса TSPAN31 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81110-NHRBS13343
Крыса TSPAN31 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81110-NMRBS13343
Крыса TSPAN31 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81110-NYRBS13343
Крыса TSPAN31 Джин клон кДНК в вектор клонированияRG81110-URBS5132
Крыса TSPAN31 Джин ORF экспрессии кДНК клона плазмидыRG81110-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name

TSPAN31 is a member of the transmembrane 4 superfamily. Most members of this family are cell-surface proteins that are characterized by the presence of four hydrophobic domains. They mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. TSPAN31 is thought to be involved in growth-related cellular processes. This gene is associated with tumorigenesis and osteosarcoma.

  • Wright MD. et al., 1995, Immunol Today. 15 (12): 588-94.
  • Meltzer PS. et al., 1992, Cell Growth Differ. 2 (10): 495-501.
  • Jankowski SA. et al., 1995, Genomics. 25 (2): 501-6.
  • Size / Price
    Каталог: RG81110-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.