Быстрый заказ

Крыса TSPAN31 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса TSPAN31 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001008378.1
    Размер кДНК:633bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus tetraspanin 31 with C terminal Flag tag.
    Синоним гена:Sas
    Виды:Rat
    переносчик:pCMV3-C-FLAG
    Plasmid:
    Участок рестрикции:
    Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with TSPAN31 qPCR primers for gene expression analysis, RP301067 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Крыса TSPAN31 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
    Крыса TSPAN31 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81110-ACGRBS15400
    Крыса TSPAN31 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81110-ACRRBS15400
    Крыса TSPAN31 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81110-CFRBS13340
    Крыса TSPAN31 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81110-CHRBS13340
    Крыса TSPAN31 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81110-CMRBS13340
    Крыса TSPAN31 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81110-CYRBS13340
    Крыса TSPAN31 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81110-NFRBS13340
    Крыса TSPAN31 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81110-NHRBS13340
    Крыса TSPAN31 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81110-NMRBS13340
    Крыса TSPAN31 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81110-NYRBS13340
    Крыса TSPAN31 Джин клон кДНК в вектор клонированияRG81110-URBS5130
    Крыса TSPAN31 Джин ORF экспрессии кДНК клона плазмидыRG81110-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    TSPAN31 is a member of the transmembrane 4 superfamily. Most members of this family are cell-surface proteins that are characterized by the presence of four hydrophobic domains. They mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. TSPAN31 is thought to be involved in growth-related cellular processes. This gene is associated with tumorigenesis and osteosarcoma.

    Ссылки
  • Wright MD. et al., 1995, Immunol Today. 15 (12): 588-94.
  • Meltzer PS. et al., 1992, Cell Growth Differ. 2 (10): 495-501.
  • Jankowski SA. et al., 1995, Genomics. 25 (2): 501-6.
  • Size / Price
    Каталог: RG81110-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».