Быстрый заказ

Крыса TRUB2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Крыса TRUB2 Информация о продукте «Клон cDNA»
Размер кДНК:971bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus TruB pseudouridine (psi) synthase homolog 2 (E. coli) with N terminal Myc tag.
Синоним гена:Trub2
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
( We provide with TRUB2 qPCR primers for gene expression analysis, RP300719 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Крыса TRUB2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Крыса TRUB2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80755-ACGRBS15400
Крыса TRUB2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80755-ACRRBS15400
Крыса TRUB2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG80755-ANGRBS15400
Крыса TRUB2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG80755-ANRRBS15400
Крыса TRUB2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80755-CFRBS13340
Крыса TRUB2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80755-CHRBS13340
Крыса TRUB2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80755-CMRBS13340
Крыса TRUB2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80755-CYRBS13340
Крыса TRUB2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80755-NFRBS13340
Крыса TRUB2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80755-NHRBS13340
Крыса TRUB2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80755-NMRBS13340
Крыса TRUB2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80755-NYRBS13340
Крыса TRUB2 Джин клон кДНК в вектор клонированияRG80755-URBS5130
Крыса TRUB2 Джин ORF экспрессии кДНК клона плазмидыRG80755-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG80755-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.