Быстрый заказ

Крыса TPST1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса TPST1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001011903.2
    Размер кДНК:1113bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus tyrosylprotein sulfotransferase 1 with N terminal HA tag.
    Синоним гена:Tpst1
    Виды:Rat
    переносчик:pCMV3-SP-N-HA
    Plasmid:
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with TPST1 qPCR primers for gene expression analysis, RP300434 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Крыса TPST1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
    Крыса TPST1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80470-ACGRBS15400
    Крыса TPST1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80470-ACRRBS15400
    Крыса TPST1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80470-CFRBS13340
    Крыса TPST1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80470-CHRBS13340
    Крыса TPST1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80470-CMRBS13340
    Крыса TPST1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80470-CYRBS13340
    Крыса TPST1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80470-NFRBS13340
    Крыса TPST1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80470-NHRBS13340
    Крыса TPST1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80470-NMRBS13340
    Крыса TPST1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80470-NYRBS13340
    Крыса TPST1 Джин клон кДНК в вектор клонированияRG80470-URBS5130
    Крыса TPST1 Джин ORF экспрессии кДНК клона плазмидыRG80470-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    Protein-tyrosine sulfotransferase 1, also known as Tyrosylprotein sulfotransferase 1 and TPST1, is a single-pass type I I membrane protein which belongs to the protein sulfotransferase family. Tyrosine O-sulfation is a common posttranslational modification of proteins in all multicellular organisms. This reaction is mediated by a Golgi enzyme activity called tyrosylprotein sulfotransferase (TPST) that catalyzes the transfer of sulfate from 3'-phosphoadenosine 5'-phosphosulfate to tyrosine residues within acidic motifs of polypeptides. Tyrosine O-sulfation has been shown to be important in protein-protein interactions in several systems. Tyrosine sulfation is mediated by one of two Golgi isoenzymes, called tyrosylprotein sulfotransferases (TPST-1 and TPST-2). A relatively small number of proteins are known to undergo tyrosine sulfation, including certain adhesion molecules, G-protein-coupled receptors, coagulation factors, serpins, extracellular matrix proteins, and hormones. TPST1 is a human tyrosylprotein sulfotransferase that uses 3'phosphoadenosine-5'phosphosulfate (PAPS) to transfer the sulfate moiety to proteins predominantly designated for secretion. TPST1 bears N-linked glycosyl residues exclusively at position Asn60 and Asn262. TPST1 and TPST2 have distinct biological roles that may reflect differences in their macromolecular substrate specificity.

    Ссылки
  • Ouyang Y.-B.et al., 1998, Proc. Natl. Acad. Sci. USA. 95: 2896-901.
  • Ouyang,Y.B. et al., 2002,J Biol Chem. 277 (26):23781-7.
  • Hoffhines, A.J. et al., 2006, J Biol Chem. 281 (49):37877-87.
  • Goettsch,S. et al., 2006, J Mol Biol. 361 (3):436-49.
  • Westmuckett, A.D. et al., 2008, Gen Comp Endocrinol. 156 (1):145-53.
  • Size / Price
    Каталог: RG80470-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».