After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Крыса TPM4 / tropomyosin 4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat TPM4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_012678.2
Размер кДНК:747bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus tropomyosin 4 with N terminal Flag tag.
Синоним гена:Tpm4
Виды:Rat
переносчик:pCMV3-SP-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса TPM4 / tropomyosin 4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Крыса TPM4 / tropomyosin 4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81616-ACGRBS15400
Крыса TPM4 / tropomyosin 4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81616-ACRRBS15400
Крыса TPM4 / tropomyosin 4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81616-CFRBS13340
Крыса TPM4 / tropomyosin 4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81616-CHRBS13340
Крыса TPM4 / tropomyosin 4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81616-CMRBS13340
Крыса TPM4 / tropomyosin 4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81616-CYRBS13340
Крыса TPM4 / tropomyosin 4 Джин клон кДНК в вектор клонированияRG81616-GRBS5130
Крыса TPM4 / tropomyosin 4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81616-NFRBS13340
Крыса TPM4 / tropomyosin 4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81616-NHRBS13340
Крыса TPM4 / tropomyosin 4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81616-NMRBS13340
Крыса TPM4 / tropomyosin 4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81616-NYRBS13340
Крыса TPM4 / tropomyosin 4 Джин ORF экспрессии кДНК клона плазмидыRG81616-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

TPM4, also known as tropomyosin 4, is a member of the tropomyosin family. Members of this family are actin-binding proteins involved in the contractile system of striated and smooth muscles and the cytoskeleton of non-muscle cells. TPM4 is expressed in cardiac tissue and platelets. It is highly expressed in the platelets of hypertensive patients. TPM4 plays a central role, in association with the troponin complex, in the calcium dependent regulation of vertebrate striated muscle contraction. Smooth muscle contraction is regulated by interaction with caldesmon. In non-muscle cells it is implicated in stabilizing cytoskeleton actin filaments.

Ссылки
  • Udeshi ND. et al., 2012, Mol Cell Proteomics. 11 (5): 148-59.
  • Rostila A. et al., 2012, Lung Cancer. 77 (2): 450-9.
  • Vlahovich N. et al., 2008, Cell Motil Cytoskeleton. 65 (1): 73-85.
  • Size / Price
    Каталог: RG81616-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».