Быстрый заказ

Крыса CD153/CD30L/TNFSF8 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat TNFSF8 Информация о продукте «Клон cDNA»
Размер кДНК:714bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus tumor necrosis factor (ligand) superfamily, member 8 with N terminal Flag tag.
Синоним гена:Tnfsf8
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса CD153/CD30L/TNFSF8 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Крыса CD153/CD30L/TNFSF8 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80148-ACGRBS15400
Крыса CD153/CD30L/TNFSF8 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80148-ACRRBS15400
Крыса CD153/CD30L/TNFSF8 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80148-CFRBS13340
Крыса CD153/CD30L/TNFSF8 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80148-CHRBS13340
Крыса CD153/CD30L/TNFSF8 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80148-CMRBS13340
Крыса CD153/CD30L/TNFSF8 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80148-CYRBS13340
Крыса CD153/CD30L/TNFSF8 Джин клон кДНК в вектор клонированияRG80148-GRBS5130
Крыса CD153/CD30L/TNFSF8 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80148-NFRBS13340
Крыса CD153/CD30L/TNFSF8 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80148-NHRBS13340
Крыса CD153/CD30L/TNFSF8 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80148-NMRBS13340
Крыса CD153/CD30L/TNFSF8 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80148-NYRBS13340
Крыса CD153/CD30L/TNFSF8 Джин ORF экспрессии кДНК клона плазмидыRG80148-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

CD30 ligand (CD30L), also known as CD153 and TNFSF8, is a membrane-associated glycoprotein belonging to the TNF superfamily and TNFR superfamily, and is a specific ligand for CD30/TNFRSF8 originally described as a cell surface antigen and a marker for Hodgkin lymphoma and related hematologic malignancies. CD30L is a type-II membrane glycoprotein expressed on activated T cells, stimulated monocyte-macrophages, granulocytes, eosinophils, and some Burkitt-like lymphoma cell lines. CD30L is capable of transducing signals through CD30 on different CD30+ lymphoma cell lines, and mediates pleiotropic biologic effects including cell proliferation, activation, differentiation, as well as cell death by apoptosis. CD30-CD30 ligand interaction has been suggested to have a pathophysiologic role in malignant lymphomas, particularly Hodgkin disease, large cell anaplastic lymphomas and Burkitt lymphomas, and is also involved in activation and functioning of the T cell-dependent immune response. Thus, CD153 and its receptor CD30 are regarded as therapeutic targets in hematologic malignancies, autoimmune and inflammatory diseases.

  • Hargreaves PG, et al. (2002) Soluble CD30 binds to CD153 with high affinity and blocks transmembrane signaling by CD30. Eur J Immunol. 32(1): 163-73.
  • Blazar BR, et al. (2004) CD30/CD30 ligand (CD153) interaction regulates CD4+ T cell-mediated graft-versus-host disease. J Immunol. 173(5): 2933-41.
  • Oflazoglu E, et al. (2009) Targeting CD30/CD30L in oncology and autoimmune and inflammatory diseases. Adv Exp Med Biol. 647: 174-85.
  • Size / Price
    Каталог: RG80148-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.